View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10845_low_3 (Length: 327)
Name: NF10845_low_3
Description: NF10845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10845_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 308
Target Start/End: Original strand, 42445173 - 42445480
Alignment:
| Q |
1 |
tagatgcagctgtggaggatggtgtggatgtaatatcgatatcacttggtctaagtgagcctcctccatttttcaatgatagcactgccataggcgcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445173 |
tagatgcagctgtggaggatggtgtggatgtaatatcgatatcacttggtctaagtgagcctcctccatttttcaatgatagcactgccataggcgcttt |
42445272 |
T |
 |
| Q |
101 |
tgcagcaattcagaagggaatctttgtaagtattgcagcaggaaactttggtccttctgatgcctccttggttaatggagccccatggatgctcacagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445273 |
tgcagcaattcagaagggaatctttgtaagtattgcagcaggaaactttggtccttctgatgcctccttggttaatggagccccatggatgctcacagtt |
42445372 |
T |
 |
| Q |
201 |
ggagcaagcactattgacagaaccattgtggcaacagcagtgcttggaaatggggaagaatttgagggcgaatctgttttccagccttccgatttctctc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445373 |
ggagcaagcactattgacagaaccattgtggcaacagcagtgcttggaaatggggaagaatttgagggcgaatctgttttccagccttccgatttctctc |
42445472 |
T |
 |
| Q |
301 |
caacactg |
308 |
Q |
| |
|
|||||||| |
|
|
| T |
42445473 |
caacactg |
42445480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University