View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10845_low_6 (Length: 271)
Name: NF10845_low_6
Description: NF10845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10845_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 83 - 265
Target Start/End: Complemental strand, 34068559 - 34068378
Alignment:
| Q |
83 |
taaaatcgatcaatagaaagatttcatgacataacaaggatatcatatttctttggttattggactcacggcgaccgggaactagctggaaaaagtggtg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34068559 |
taaaatcgatcaatagaaagatttcatgacataacaaggatatcatatttctttggttattggactcacggcgaccgggaactagctggaaaaagtggtg |
34068460 |
T |
|
| Q |
183 |
gttctgaaattcaacttgacgatagaagaaatacatgagtaagttatatatatgagagtgagtcatatgatgaagaatatatt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
34068459 |
gttctgaaattcaacttgacgatagaagaaatacatgagtgagttatatatatgagagt-agctatatgatgaagaatatatt |
34068378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 14 - 85
Target Start/End: Complemental strand, 34070998 - 34070927
Alignment:
| Q |
14 |
gaatggagaacgaagttagcgaatcatatgatatttatatttgttctatatttattttttgagtcatgttaa |
85 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34070998 |
gaatggagaacgaagttagtgaatcatatgatatttatatttgttctatatttattttttgggtcatgttaa |
34070927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University