View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10845_low_9 (Length: 249)
Name: NF10845_low_9
Description: NF10845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10845_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 4 - 244
Target Start/End: Complemental strand, 28799112 - 28798872
Alignment:
| Q |
4 |
cttaacaaggtggtctctcagaaattcatgtatagttgcatcaaacatcaaaagcagctgcagcttttacaagcacaccaaagagaatgaaaggagtaga |
103 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28799112 |
cttaacaaggtgggctctcagaaattcatgtatagttgcatcaaacatcaaaagcagctgcagcttttacaagcacaccaaagagaatgaaaggagtaga |
28799013 |
T |
 |
| Q |
104 |
gaagaaaggactatgatcactattttctagttcatacacattcaatggtggccacctcttgatcatggcttcttgttgttctggcttcactactttgtca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28799012 |
gaagaaaggactatgatcactattttctagttcatacacattcaatggtggccacctcttgatcatggcttcttgttgttctggcttcaccactttgtca |
28798913 |
T |
 |
| Q |
204 |
tgttttgtccttatgtacacccggggtactttctctgcttc |
244 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28798912 |
tgttttgtccttatgtacacgcggggtactttctctgcttc |
28798872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 62 - 238
Target Start/End: Original strand, 42821800 - 42821973
Alignment:
| Q |
62 |
tgcagcttttacaagcacaccaaagagaatgaaaggagtagagaagaaaggactatgatcactattttctagttcatacacattcaatggtggccacctc |
161 |
Q |
| |
|
||||||||| ||||||| ||||||||| || || || ||||||||||| |||||||| ||||| | | | |||||||||| | |||||||||||| |
|
|
| T |
42821800 |
tgcagctttaacaagcaaaccaaagagtataaatggggtagagaagaagggactatggtcactgt---ccaattcatacacactacctggtggccaccta |
42821896 |
T |
 |
| Q |
162 |
ttgatcatggcttcttgttgttctggcttcactactttgtcatgttttgtccttatgtacacccggggtactttctc |
238 |
Q |
| |
|
|| ||||||||||| ||||| | ||| || ||||| ||||| ||| ||||| |||||||||| ||||| || ||||| |
|
|
| T |
42821897 |
tttatcatggcttcctgttgctttggttttactacattgtcttgtcttgtctttatgtacacacggggcaccttctc |
42821973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University