View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10846_high_2 (Length: 259)
Name: NF10846_high_2
Description: NF10846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10846_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 47178892 - 47178644
Alignment:
| Q |
1 |
caaaggcaaacagttctgtgtggaaaaaacaagccaaccaattcaaaagcataatcaattgtgggaacaagcatatagagaggacaatcacacagttcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47178892 |
caaaggcaaacagttctgtgtggaaaaaacaagccaaccaattcaaaagcataatcaattgtgggcacaagcatatagagaggacaatcacacagttcaa |
47178793 |
T |
|
| Q |
101 |
atagtttaaaaacacatgaatgacactgccaccatcaccaccaacaccacaatggttgagctttgccatcagctagcattttgcgatttttcatttagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
47178792 |
atagtttaaaaacacatgaatgacactgccaccatcaccaccaacaccacaatggttgagctttgccatcagctagcattttccgatttttcatttatta |
47178693 |
T |
|
| Q |
201 |
gttaagatggaaatgatatggagcgctggattcatcatagggtggatat |
249 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47178692 |
gttaggatggaaatgatatggagcgctggattcatcatagggtggatat |
47178644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 215 - 249
Target Start/End: Original strand, 47179016 - 47179050
Alignment:
| Q |
215 |
gatatggagcgctggattcatcatagggtggatat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47179016 |
gatatggagcgctggattcatcatagggtagatat |
47179050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University