View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10847_low_5 (Length: 215)
Name: NF10847_low_5
Description: NF10847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10847_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 17 - 198
Target Start/End: Original strand, 8404623 - 8404804
Alignment:
| Q |
17 |
gaagacactctatagtattggaaaggaactagggaggggtcaatttggtgtcacttatctttgtaccgaaaatgccaccggaagaaactatgcttgtaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8404623 |
gaagacactctatagtattggaaaggaactagggaggggtcaatttggtgtcacttatctttgtaccgaaaatgccactggaagaaactatgcttgtaag |
8404722 |
T |
|
| Q |
117 |
tccatttcgagacgaaagctaacaagaaagaaagaaattgaggatgttaaaagggaaatcatgatccttcaggacttaagtg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8404723 |
tccatttcgagacgaaagctaacaagaaagaaagaaattgaggatgttaaaagggaaatcatgatccttcaggacttaagtg |
8404804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University