View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_high_24 (Length: 364)
Name: NF1084_high_24
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 104 - 285
Target Start/End: Complemental strand, 7372808 - 7372631
Alignment:
| Q |
104 |
cagctgtgagtgagatcttgaatgagattacgagaagaggtggagtattaatcaaaatatcatccacttaaactaaaacatagaggacaatagcgttctt |
203 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7372808 |
cagctgtgaatgagatcttgaatgagattacgagaagaagtggagtattaatcaaaatatcatccacttaaactaaaacatagaggacaatagcgttctt |
7372709 |
T |
 |
| Q |
204 |
atgaagnnnnnnnntgagaagagatggatcacatccgctgcgcctaaaccaatttgaagcaaaaaagatatcgagcattcat |
285 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7372708 |
atgaa----aaaaatgagaagagatggatcacatccgctgcgcctaaaccaatttgaagcaaaaaagatattgagcattcat |
7372631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University