View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_high_39 (Length: 313)
Name: NF1084_high_39
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_high_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 11286250 - 11285951
Alignment:
| Q |
1 |
tgctgtcgacggggtgcagatgattgggatgaaggtatcatataatgacaacgatgacctattgaacaattttataattgtttgttgatgttagtgtgtt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11286250 |
tgctgtcgactgggtgcagatgattgggatgaaggtatcatataatgataacgatgacctattgaacaattttataattgtttgttgatgttagtgtgtt |
11286151 |
T |
|
| Q |
101 |
aacattcaattttaatgtctttgtgtagcctggtccggaatctattggtatcgttgctgtttcccgcaactctagtgggatagcggcgcgagcctgcggc |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11286150 |
aacagtcaattttaatgtctttgtgtagcctggtccggaatctattggtatcgttgctgtttcccgcaactctagtgggatagcggcgcgagcctgtggc |
11286051 |
T |
|
| Q |
201 |
cttgtgagtctggagcccactaaggtagtattttgttgttgatttgtttccttgttgctgttgaacaatgaaactgtgattactttttaataacttgtct |
300 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
11286050 |
cttgtgagtctagagcccactaaggtagtattttgttgttgatttgtttcctcgttgctgtcgaacaatgaaattgtgattcctttttaataacttgtct |
11285951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University