View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_high_59 (Length: 251)
Name: NF1084_high_59
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_high_59 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] scaffold0215 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 51 - 251
Target Start/End: Original strand, 49233310 - 49233509
Alignment:
| Q |
51 |
tgcatttcactttccgtgttttgtaggttgagttatcccccaattcagttccaagctttggtagagcctacaatatcaacgatctctttgccacttaatt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49233310 |
tgcatttcactttccgtgttttgtaggttgagttatcccccaattcagttccaagctt-ggtagagcctacaatatcaacgatctgcttgccacttaatt |
49233408 |
T |
|
| Q |
151 |
tgctacacggttggtctcaatgacggtttggttattatcactctgcctattgtcagaaatggttgaatctgcactctcgattacagggttctgcaaagga |
250 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49233409 |
tgctacacggttagtctcaatgacggtttggttattatcactctgcctattgtcagacttggttgaatctgcactctcgattacagggttctgcaaagga |
49233508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 9 - 251
Target Start/End: Complemental strand, 50863209 - 50862968
Alignment:
| Q |
9 |
agcagagacatagcttttcaaactaatccttctcaaccttattgcatttcactttccgtgttttgtaggttgagttatcccccaattcagttccaagctt |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50863209 |
agcagacacatagcttttcaaactaatccttctcaaccttagtgcatttcactttccgtgttttgtaggttgagttatcccccaattcagttccaagctt |
50863110 |
T |
|
| Q |
109 |
tggtagagcctacaatatcaacgatctctttgccacttaatttgctacacggt-tggtctcaatgacggtttggttattatcactctgcctattgtcaga |
207 |
Q |
| |
|
| ||| ||||||||| |||||| || |||||||||||||||||||||||| | |||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
50863109 |
t--tagggcctacaatgtcaacggtccgcttgccacttaatttgctacacggtgtagtctcaatgacggtttggttattatcaccctgcctgttgtcaga |
50863012 |
T |
|
| Q |
208 |
aatggttgaatctgcactctcgattacagggttctgcaaaggac |
251 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
50863011 |
cttggttgaatccgcactctcgattatagggttctgcaaaggac |
50862968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0215 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: scaffold0215
Description:
Target: scaffold0215; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 9 - 190
Target Start/End: Complemental strand, 20634 - 20453
Alignment:
| Q |
9 |
agcagagacatagcttttcaaactaatccttctcaaccttattgcatttcactttccgtgttttgtaggttgagttatcccccaattcagttccaagctt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
20634 |
agcagagacatagcttttcaaactaatccttctcaaccttagtgcacttcactttccgtgttttgtaggttgagttatcccccaatacagttccaagc-t |
20536 |
T |
|
| Q |
109 |
tggtagagcctacaatatcaacgatctctttgccacttaatttgctacacggt-tggtctcaatgacggtttggttattatca |
190 |
Q |
| |
|
|||||| ||||||||| ||||| || ||| |||||||||||||||||| | | ||||||||||||||||||||||||||| |
|
|
| T |
20535 |
tggtagggcctacaatggcaacggtccgcttgtcacttaatttgctacacgatgtagtctcaatgacggtttggttattatca |
20453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University