View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_high_61 (Length: 251)
Name: NF1084_high_61
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_high_61 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 146 - 251
Target Start/End: Original strand, 36247673 - 36247778
Alignment:
| Q |
146 |
agtacgatcctaatttatcacgtttgtaaaacaaggtttttagatcaaacattgtataacttaaattctaatttcctatccttgnnnnnnnagagaccaa |
245 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
36247673 |
agtacgatcctaatttatgatgtttgtaaaacaaggtttttagatcaaacattgtataacttaaattctgatttcctatccttgtttttttagagaccaa |
36247772 |
T |
 |
| Q |
246 |
actcat |
251 |
Q |
| |
|
|||||| |
|
|
| T |
36247773 |
actcat |
36247778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University