View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_high_62 (Length: 251)
Name: NF1084_high_62
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_high_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 48 - 225
Target Start/End: Complemental strand, 28284119 - 28283942
Alignment:
| Q |
48 |
ccctcacttttccaaaaacacatatgcccctt-ctagtcaaatttccacgagtaggaagacaaccaaaaataagttggcatgaaaatatttggacctttt |
146 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28284119 |
ccctcacttttccaaaaacacat--gcccctttctagtcaaatttccacgagtaggaagacaaccaaaaataatttggcatgaaaatatttggacctttt |
28284022 |
T |
 |
| Q |
147 |
-gttggatgaaatcgatgaatttttctataacttgtaaaaagaatttaaaaaatatagtttctaagtacttgatgaaatt |
225 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
28284021 |
tgttggatgaaatagatgaatttttctataacttgtaaaaagaatttaataaatttagtttctaagtacttgatgaaatt |
28283942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University