View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_high_68 (Length: 247)
Name: NF1084_high_68
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_high_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 179 - 242
Target Start/End: Original strand, 48666403 - 48666466
Alignment:
| Q |
179 |
aaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48666403 |
aaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
48666466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 242
Target Start/End: Original strand, 48655834 - 48655890
Alignment:
| Q |
186 |
actgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
242 |
Q |
| |
|
||||| |||||||| ||||| ||| ||||| ||||||||||||||||| ||||||| |
|
|
| T |
48655834 |
actgcatcctccgctgccttcttccacttgattgcatttttcttcaactcctctgct |
48655890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 2 - 66
Target Start/End: Complemental strand, 9418198 - 9418134
Alignment:
| Q |
2 |
atgatgctttggatgagcaactttagaaggttatcccactcagaggtatgaataattttaacatg |
66 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||| ||||||||||| ||||||||||||||| |
|
|
| T |
9418198 |
atgatgctttggaagagcaactttagaaggtcatccaactcagaggtaataataattttaacatg |
9418134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 2 - 59
Target Start/End: Original strand, 12003384 - 12003441
Alignment:
| Q |
2 |
atgatgctttggatgagcaactttagaaggttatcccactcagaggtatgaataattt |
59 |
Q |
| |
|
||||||||||| | ||||||||||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
12003384 |
atgatgctttgcaagagcaactttagaaggtcatccaactcagaggtaataataattt |
12003441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University