View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1084_low_100 (Length: 251)

Name: NF1084_low_100
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1084_low_100
NF1084_low_100
[»] chr2 (1 HSPs)
chr2 (48-225)||(28283942-28284119)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 48 - 225
Target Start/End: Complemental strand, 28284119 - 28283942
Alignment:
48 ccctcacttttccaaaaacacatatgcccctt-ctagtcaaatttccacgagtaggaagacaaccaaaaataagttggcatgaaaatatttggacctttt 146  Q
    |||||||||||||||||||||||  ||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
28284119 ccctcacttttccaaaaacacat--gcccctttctagtcaaatttccacgagtaggaagacaaccaaaaataatttggcatgaaaatatttggacctttt 28284022  T
147 -gttggatgaaatcgatgaatttttctataacttgtaaaaagaatttaaaaaatatagtttctaagtacttgatgaaatt 225  Q
     |||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||    
28284021 tgttggatgaaatagatgaatttttctataacttgtaaaaagaatttaataaatttagtttctaagtacttgatgaaatt 28283942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University