View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_105 (Length: 250)
Name: NF1084_low_105
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_105 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 10 - 239
Target Start/End: Complemental strand, 10654231 - 10654002
Alignment:
| Q |
10 |
agaatagttttcagatggcaagcgaacttgcgtgcattttgctttaatgattttcctttcttcaatgatacattcacagtattggtgtatttgatggttt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10654231 |
agaatagttttcagatggcaagcgaacttgcgtgcatttcgctttaatgattttcctttcttcaatgatacattcacagtattggtgtatttgatggttt |
10654132 |
T |
|
| Q |
110 |
tatgtgaggctaatatataagataaaaaatgatttagtactacaagacacttaagtatatgtgtttagaaaagaggaattttaaaactcaatttaagcct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10654131 |
tatgtgaggctaatatataagataaaaaatgatttagtactacaagacacttaagtatatgtgtttagaaaagaggaattttaaaactcaatttaagcct |
10654032 |
T |
|
| Q |
210 |
cttgtatttttcatgtttattcagtttcat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10654031 |
cttgtatttttcatgtttattcagtttcat |
10654002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University