View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_109 (Length: 239)
Name: NF1084_low_109
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_109 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 10 - 239
Target Start/End: Complemental strand, 53090291 - 53090053
Alignment:
| Q |
10 |
ttctgcttttaatttttacttttgtctgtgcacaatatataagtaaattcatttgtgttttcaatatagcgtgacaagagaaatgctagcaacacacatt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53090291 |
ttctgcttttaatttttacttttgtctgtgcactatatataagtaaattcatttgtgctttcaatatagtgtgacaagagaaatgctagcaacacacatt |
53090192 |
T |
 |
| Q |
110 |
gttggaaaatgtatgttagaatgtgtgttgataacattt-------ctcagtttgacaatatgatgcgacatgagtgatagatatactcaaatgggtgtt |
202 |
Q |
| |
|
||| ||| | |||||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53090191 |
attgaaaagtatatgttagaacgtgtgttgataacatttctcatttctcagtttaacaatatgatgcgacatgagtgatagatatactcaaatgggtgtt |
53090092 |
T |
 |
| Q |
203 |
gc--tatatctcccaataaaatatatagcgaatgattca |
239 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53090091 |
gctatatatctcccaataaaatatatagcgaatgattca |
53090053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University