View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_120 (Length: 214)
Name: NF1084_low_120
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_120 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 6e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 7 - 197
Target Start/End: Original strand, 4167070 - 4167264
Alignment:
| Q |
7 |
gcagcaccacagacacaatggtagagaaacaaattggctaaatccacctcttactcacacaccttggctccttgtgaatggccaatatgtgaatgctgat |
106 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4167070 |
gcagctccatagacacaatggtagagaaacaaattggctaaatccacctcttactcacacaccttggctccttgtgaatggccaatatgtgaatgctgat |
4167169 |
T |
|
| Q |
107 |
gttagtaac----nnnnnnnnncttaactaacatattaatctttgataacttaagcacttatatttctctcccttattaatattcctaattcttt |
197 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4167170 |
gttagtaactttttttttttttcttaactaacatattaatctttgataacttaaacacttatatttctctcccttattaatattcctaattcttt |
4167264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 197
Target Start/End: Original strand, 4174212 - 4174251
Alignment:
| Q |
158 |
cacttatatttctctcccttattaatattcctaattcttt |
197 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
4174212 |
cacttaaatttctctcccttattaacattcctaattcttt |
4174251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University