View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_45 (Length: 354)
Name: NF1084_low_45
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 12 - 223
Target Start/End: Complemental strand, 9222932 - 9222723
Alignment:
| Q |
12 |
caacaatatttttgcattctcgttagtgacataaattacggtggcaacaataatttacctataaaagtttgtgttttagcacataaagtaattgtgtatt |
111 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9222932 |
caacaatatttttgcattctggttagtgacataaattacggtggcaacaataatttacctataaaagtttgtgttttagcacataaagtaattttgtatt |
9222833 |
T |
|
| Q |
112 |
ggctaaatttttcaaatatccaaaataatagagacaccgtcataattctatatggtctaaatttttatctatctcatcatatgagtttaaactttaaatt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9222832 |
ggctaaatttttcaaatatccaaaataat--agacaccgtcataattctatatggtctaaatttttatctatctcatcgtatgagtttaaactttaaatt |
9222735 |
T |
|
| Q |
212 |
gatataaaagac |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9222734 |
gatataaaagac |
9222723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University