View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_47 (Length: 353)
Name: NF1084_low_47
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 9222928 - 9222723
Alignment:
| Q |
15 |
aatatttttgcattctcgttagtgacataaattacggtggcaacaataatttacctataaaagtttgtgttttagcacataaagtaattgtgtattggct |
114 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9222928 |
aatatttttgcattctggttagtgacataaattacggtggcaacaataatttacctataaaagtttgtgttttagcacataaagtaattttgtattggct |
9222829 |
T |
 |
| Q |
115 |
aaatttttcaaatatccaaaataatagagacaccgtcataattctatatggtctaaatttttatctatctcatcatatgagtttaaactttaaattgata |
214 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9222828 |
aaatttttcaaatatccaaaataat--agacaccgtcataattctatatggtctaaatttttatctatctcatcgtatgagtttaaactttaaattgata |
9222731 |
T |
 |
| Q |
215 |
taaaagac |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
9222730 |
taaaagac |
9222723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University