View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_68 (Length: 320)
Name: NF1084_low_68
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_68 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 5e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 95 - 320
Target Start/End: Original strand, 34451899 - 34452124
Alignment:
| Q |
95 |
acaatagttttgtagctttagtttgttgcattgcattgtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgtc |
194 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34451899 |
acaatagttctgtagctttagtttgttgcattgcatggtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgtc |
34451998 |
T |
 |
| Q |
195 |
atatgatgggaacagtccnnnnnnngcaacctacagtattaccctttcttctttaattagatctttcatcatcaattcacaaagatcaaacnnnnnnnnn |
294 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
34451999 |
atatgatgggaacagtccaacaaaagcaacctacagtattaccttttcttctttaatcagatctttcatcatcaattcacaaagatcaagcttttttttt |
34452098 |
T |
 |
| Q |
295 |
gcatcacaataacatcctttccttgt |
320 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
34452099 |
gcatcacaataacatcctttccttgt |
34452124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University