View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_80 (Length: 284)
Name: NF1084_low_80
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_80 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 95 - 255
Target Start/End: Original strand, 23433936 - 23434096
Alignment:
| Q |
95 |
agaagaacataatgagattcaactagttctagagttaaagaaataaagggtctttaattaatcaaaagttttatagttattttgtaagataactattatt |
194 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23433936 |
agaagaacataatgagattcaaccagttctagagttaaagaaataaagggtctttaattaatcaaaagttttatagttattttgtaagataactattatt |
23434035 |
T |
|
| Q |
195 |
atgtttgtgggtatcccagcttgttgggagaaattgcagggaagaaccaagaagtaggaat |
255 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23434036 |
atgtttgcgggtatcccagcttgttgggagaaattgcagggaagaaccaagaagtaggaat |
23434096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University