View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_82 (Length: 274)
Name: NF1084_low_82
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_82 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 6e-80; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 46 - 221
Target Start/End: Original strand, 37831935 - 37832116
Alignment:
| Q |
46 |
ttaatcacctattatggtgtctcctggtttggtgatccatgttaatcacttggttagaaagacaacatgttttataactgcattgtgttgcaagatgcct |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37831935 |
ttaatcacctattatggtgtctcctggtttggtgatccatgttaatcacttggttagaaagacagcatgttttataactgcattgtgttgcaagatgcct |
37832034 |
T |
|
| Q |
146 |
gtcaatgatggtgtgtttcctcattttgaacatcaaaggtgtag------tccgagtctacatagcgttatttaataataat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
37832035 |
gtcaatgatggtgtgtttcctcattttgaacatcaaaggtgtagtcgaaatccgcgtctacatagcgttatttaataataat |
37832116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 37831850 - 37831893
Alignment:
| Q |
1 |
tctgtgttggttaagaagcttcagttctttggtccaacattatt |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37831850 |
tctgtgttggttaagaagcttcagttctttggtccaacattatt |
37831893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 41
Target Start/End: Original strand, 37839993 - 37840027
Alignment:
| Q |
7 |
ttggttaagaagcttcagttctttggtccaacatt |
41 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37839993 |
ttggttaagaagcttcagttctttggtacaacatt |
37840027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 106 - 155
Target Start/End: Original strand, 37840145 - 37840194
Alignment:
| Q |
106 |
gacaacatgttttataactgcattgtgttgcaagatgcctgtcaatgatg |
155 |
Q |
| |
|
|||| |||||||||||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
37840145 |
gacagcatgttttataactgctctttgttgcaagatgcctgtcactgatg |
37840194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 7 - 44
Target Start/End: Complemental strand, 38400088 - 38400051
Alignment:
| Q |
7 |
ttggttaagaagcttcagttctttggtccaacattatt |
44 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38400088 |
ttggttaagaagcttcagttctttggtacaacattatt |
38400051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 155
Target Start/End: Complemental strand, 38382538 - 38382440
Alignment:
| Q |
57 |
ttatggtgtctcctggtttggtgatccatgttaatcacttggttagaaagacaacatgttttataactgcattgtgttgcaagatgcctgtcaatgatg |
155 |
Q |
| |
|
||||||||| | ||||||| | | ||| ||| | ||||||||| | || |||| |||| ||||||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
38382538 |
ttatggtgtatactggtttagcggtccttgtaactcacttggtcaaaatgacagcatgctttataactgccctttgttgcaagatgcctgtcactgatg |
38382440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University