View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_85 (Length: 265)
Name: NF1084_low_85
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_85 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 90 - 185
Target Start/End: Complemental strand, 11555891 - 11555796
Alignment:
| Q |
90 |
caagtgactgtaaattatggtactatcataacttactaaccttttcatttcccaagcatcctttcgatatgtgatttaaatttcattgttcatctc |
185 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
11555891 |
caagtgactgtaaattatagtactatcataacttactaaccttttcatttcccaagcatcctttcgatatgtgatgtaaatttcattgttcttctc |
11555796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 122 - 185
Target Start/End: Complemental strand, 11530213 - 11530150
Alignment:
| Q |
122 |
ttactaaccttttcatttcccaagcatcctttcgatatgtgatttaaatttcattgttcatctc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
11530213 |
ttactaaccttttcatttcccaagcatcctttcgatatgtgatgtaaatttcattgttcttctc |
11530150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University