View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_90 (Length: 259)
Name: NF1084_low_90
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_90 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 230
Target Start/End: Original strand, 31789714 - 31789935
Alignment:
| Q |
11 |
cagagatgacgcaagtaacacagtgaccaaagtagagcaactatcctttctgtttacctcgaatggtttttaggtaatgttggaccacacctatattgag |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789714 |
cagaaatgacgcaagtaacacagtgaccaaagtagagcaactatcctttctgtttacctcgaatggtttttaggtaatgttggaccacacctatattgag |
31789813 |
T |
 |
| Q |
111 |
gagcttcaatgg--gnnnnnnngggttgcattgcagctttttgattagtttataactttgatcatgtggctcctactccaaggaagtcaataaatggaat |
208 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789814 |
gagcttcaatggaaaaaaaaaagggttgcattgcagctttttgattagtttataactttgatcatgtggctcctactccaaggaagtcaataaatggaat |
31789913 |
T |
 |
| Q |
209 |
tgcatctgaaggagggggatta |
230 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31789914 |
tgcatctgaaggagggggatta |
31789935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University