View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_91 (Length: 255)
Name: NF1084_low_91
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_91 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 33 - 146
Target Start/End: Original strand, 36370461 - 36370574
Alignment:
| Q |
33 |
attttgtacctgcttccacaagtgttgtttactgtataactgattattttgatgtgtaccaagttaacataattcatatctaggccaagcacacaacgag |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36370461 |
attttgtacctgcttccacaagtgttgtttactgtataactgattattttgatgtgtaccaagttaacataattcatatctaggccaagcacacaacgag |
36370560 |
T |
 |
| Q |
133 |
aataacatgaataa |
146 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36370561 |
aataacatgaataa |
36370574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University