View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_93 (Length: 252)
Name: NF1084_low_93
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_93 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 31 - 244
Target Start/End: Original strand, 56388121 - 56388337
Alignment:
| Q |
31 |
tggtgtctgcttcggaggacccatcatcaccatcgctacactacttcttttcttttgtttctgctacacttcaa---gtctcatctcattgttttcatcg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
56388121 |
tggtgtctgcttcggaggacccatcatcaccatcgctacactacttcttttcttttgtttctgctacacttctactagtctcatctcattgttttcatcg |
56388220 |
T |
 |
| Q |
128 |
cagcagcagcagcattattcaaatcaacaacatggccattcgctgtctcctctcctcttctcacccgtcagattaatctaatggattaggggaaacaaat |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
56388221 |
cagcagcagcagcagcattcaaatcaacaacatggccattcgctgtctcctctcctcttctcacccgtcagattaatctaatggattaagtgaaacaaat |
56388320 |
T |
 |
| Q |
228 |
ttcctttctttcttctc |
244 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
56388321 |
tccctttctttcttctc |
56388337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University