View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_94 (Length: 252)
Name: NF1084_low_94
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_94 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 63 - 198
Target Start/End: Complemental strand, 1552966 - 1552831
Alignment:
| Q |
63 |
cttccaaccacgtggacactatgttccactccactgtgctctttctatcttttgctattgttgatgttaatttaggtagataaacacaagcaaatgcaaa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1552966 |
cttccaaccacgtggacactatgttccactccactgtgctctttctatcttttgctattgttgatgttaatttaggtagataaacacaagcaaatgcaaa |
1552867 |
T |
|
| Q |
163 |
caaaaaccaatttaatgaagtaagatgtgtctgtgg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1552866 |
caaaaaccaatttaatgaagtaagatgtgtctgtgg |
1552831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University