View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1084_low_95 (Length: 251)
Name: NF1084_low_95
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1084_low_95 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 21123549 - 21123754
Alignment:
| Q |
1 |
tctggtggtccgtctattgaggatcttggtcaccatgctggatactattcgcttcctcgttccaactcttcaaggtaaattaatattcttcttattataa |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21123549 |
tctggtggtccttctattgaggatcttggtcaccatgctggatactattcgcttcctcgttccaactcttcaaggtaaattaata---ttcttattataa |
21123645 |
T |
|
| Q |
101 |
ttt-gggggattaatttatcttcttc-nnnnnnnntattcttcttattgaaatgaagttaggagttggcgatgatataaattgtgtgaatattttgataa |
198 |
Q |
| |
|
||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21123646 |
tttggggggattaatttatcttcttcaaaaaaaaatattcttcttattgaaatgaagttaggagttggcgatgatataaattgtgtgaatattttgataa |
21123745 |
T |
|
| Q |
199 |
tacgattta |
207 |
Q |
| |
|
||||||||| |
|
|
| T |
21123746 |
tacgattta |
21123754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 6 - 78
Target Start/End: Original strand, 21143477 - 21143549
Alignment:
| Q |
6 |
tggtccgtctattgaggatcttggtcaccatgctggatactattcgcttcctcgttccaactcttcaaggtaa |
78 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||||| |||||||| ||||||||||||||||| || |||||||| |
|
|
| T |
21143477 |
tggtccttctattgaagatcttggtcatcatgccggatactactcgcttcctcgttccaaatccgcaaggtaa |
21143549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 65
Target Start/End: Original strand, 21149295 - 21149347
Alignment:
| Q |
13 |
tctattgaggatcttggtcaccatgctggatactattcgcttcctcgttccaa |
65 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
21149295 |
tctattgataatcttggtcaccatgccggatactattcacttcctcattccaa |
21149347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University