View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10850_high_4 (Length: 238)
Name: NF10850_high_4
Description: NF10850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10850_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 35 - 223
Target Start/End: Original strand, 7181330 - 7181518
Alignment:
| Q |
35 |
gaccttgtatatattttgaatggtttttaaaccctcttctttgtctaaactcctagtttatgaggttatttttagtggttaaagtatctcttatactttt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7181330 |
gaccttgtatatattttgaatggtttttcaaccctcttctttgtctaaactcctagtttatgaggttatttttagtggttaaagtatctcttatactttt |
7181429 |
T |
 |
| Q |
135 |
tccgatttgtgggttatgtattctttatattgctatatggtattcaataaattttgttattnnnnnnntaatctgctataggtagaagg |
223 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7181430 |
tccgacttgtgggttatgtattctttatattgctatatggtattcaataaattttgttattaaaaaaataatctgctataggtagaagg |
7181518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University