View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10850_low_4 (Length: 250)
Name: NF10850_low_4
Description: NF10850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10850_low_4 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 169 - 250
Target Start/End: Original strand, 7181163 - 7181244
Alignment:
| Q |
169 |
aaacatcgaaaaaggttaactctaatttgatatacaactatttgaaagaattggtaacatggtgaaacaaaattattttctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7181163 |
aaacatcgaaaaaggttaactctaatttgatatacaacaatttgaaagatttggtaacatggtgaaacaaaattattttctc |
7181244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 48 - 101
Target Start/End: Original strand, 7181095 - 7181148
Alignment:
| Q |
48 |
gtgtcgctttgtcggaagagtttggtatttgattcttagtaagtggataggaac |
101 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7181095 |
gtgtcgctttgtcgaaagagtttggtatttgattcttaataagtggataggaac |
7181148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University