View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10851_high_6 (Length: 238)

Name: NF10851_high_6
Description: NF10851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10851_high_6
NF10851_high_6
[»] chr1 (2 HSPs)
chr1 (27-82)||(28738747-28738802)
chr1 (163-224)||(28738842-28738903)


Alignment Details
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 27 - 82
Target Start/End: Original strand, 28738747 - 28738802
Alignment:
27 tacgattccatggtagctaccatcacctgcaaactggaatcacctcttgtatattt 82  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||| |||||    
28738747 tacgattccatggtagctaccatcacctccaaactggaatcacctcttgtgtattt 28738802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 224
Target Start/End: Original strand, 28738842 - 28738903
Alignment:
163 gattgagttagaccatggtttaaaaggtgaacttgaaataacggtgcgacggtgcattatct 224  Q
    ||||||||||||||||| || |||||||||||||  ||| |||||| ||| |||||||||||    
28738842 gattgagttagaccatgattaaaaaggtgaacttagaatgacggtgtgacagtgcattatct 28738903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University