View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10851_low_10 (Length: 245)
Name: NF10851_low_10
Description: NF10851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10851_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 15 - 121
Target Start/End: Original strand, 17531288 - 17531396
Alignment:
| Q |
15 |
aagaaaacaatgtttatgta--atatagctataactatgtttgatttaaggaaaataaaattattcggatgttgcaaatgatatgtgtgattttaaggtg |
112 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17531288 |
aagaaaacaatgtttatgtataatatagctataactatgtttgatttaaggaaaataaaattattcggatgttgcaaatgatatgtgtgattttaaggtg |
17531387 |
T |
|
| Q |
113 |
ttaaaatag |
121 |
Q |
| |
|
| ||||||| |
|
|
| T |
17531388 |
tgaaaatag |
17531396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 143 - 200
Target Start/End: Original strand, 17531384 - 17531440
Alignment:
| Q |
143 |
ggtgttaaaatagttttaatgtcaaacaaaagagacttcttatattaaaactttgatt |
200 |
Q |
| |
|
||||| ||||||||| || |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17531384 |
ggtgtgaaaatagttata-tgtcaaacaaaatagacttcttatattaaaactttgatt |
17531440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University