View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10851_low_12 (Length: 238)
Name: NF10851_low_12
Description: NF10851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10851_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 27 - 82
Target Start/End: Original strand, 28738747 - 28738802
Alignment:
| Q |
27 |
tacgattccatggtagctaccatcacctgcaaactggaatcacctcttgtatattt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
28738747 |
tacgattccatggtagctaccatcacctccaaactggaatcacctcttgtgtattt |
28738802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 163 - 224
Target Start/End: Original strand, 28738842 - 28738903
Alignment:
| Q |
163 |
gattgagttagaccatggtttaaaaggtgaacttgaaataacggtgcgacggtgcattatct |
224 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| ||| |||||| ||| ||||||||||| |
|
|
| T |
28738842 |
gattgagttagaccatgattaaaaaggtgaacttagaatgacggtgtgacagtgcattatct |
28738903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University