View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10851_low_13 (Length: 228)
Name: NF10851_low_13
Description: NF10851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10851_low_13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 23628415 - 23628637
Alignment:
| Q |
6 |
gagccatgcggttagttcgtgacacgagacagtgcttgcaccacctctttcttccggttcagttaaaccggattcaagtggcaaaactggacccacggcc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23628415 |
gagccatgcggttagttcgtgacacgagacagtgcttgcaccacctctttcttccggttcagttaaaccggattcaagtggcaaaactggacccacggcc |
23628514 |
T |
 |
| Q |
106 |
cgaactctctcgtgtccaagttctttcttcatatggttcaagtaagccggttctaaatcaatgaaagagttgaaaaccactccccaagcttcatgattaa |
205 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23628515 |
caaactctctcgtgtccaagttctttcttcatatggtttaagtaagccggttctaaatcaatgaaagagttgaaaaccactccccaagcttcatgattaa |
23628614 |
T |
 |
| Q |
206 |
atagaaaatcgttttttatattc |
228 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
23628615 |
atagaaaatcgttctttatattc |
23628637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University