View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10851_low_17 (Length: 212)
Name: NF10851_low_17
Description: NF10851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10851_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 194
Target Start/End: Complemental strand, 5740855 - 5740675
Alignment:
| Q |
14 |
agacacacacatataactttagatgcgtctcatggatattttagatagggttgactaaaaatatgacagaaaagacaaacttatgctgaaatgagtggcg |
113 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
5740855 |
agacacacacatataactttaggtgcgtctcatggatattttagatagggttgactaaaaatatgacagaaaagacaaacttatgttaaaatgagtggcg |
5740756 |
T |
 |
| Q |
114 |
taagagaaactttttaaatgtaaggaaacatttgaaacattaaataaacatatgggatcaaatttgaaattaaaccccact |
194 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5740755 |
taagagaagctttttaaatgtagggaaacatttgaaacattaaataaacatatgggatcaaatttgaaattaaaccccact |
5740675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University