View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10851_low_5 (Length: 281)
Name: NF10851_low_5
Description: NF10851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10851_low_5 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 150 - 281
Target Start/End: Original strand, 24728401 - 24728532
Alignment:
| Q |
150 |
cacctgcacaacaattctcatgcatcctccacaatcatcacctatgtaatggaaaaacacttgtaatttccaattatacgctctatctggtctagaagtg |
249 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24728401 |
cacctgcacaacaattctcatacatcctccacaatcatcacctatgtaatggaaaaacacttgtaatttccaattatacgctctatctggtctagaagtg |
24728500 |
T |
|
| Q |
250 |
taacaatactcataaaaagaaacgtagttcta |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24728501 |
taacaatactcataaaaagaaacgtagttcta |
24728532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 33 - 99
Target Start/End: Original strand, 24728284 - 24728350
Alignment:
| Q |
33 |
tcgttatattgcatgaactaaactttgtacttctcacttggtgtttggaatcgagtgagttgcaact |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24728284 |
tcgttatattgcatgaactaaactttgtacttctcgcttggtgtttggaatcgagtgagttgcaact |
24728350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University