View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10851_low_8 (Length: 259)
Name: NF10851_low_8
Description: NF10851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10851_low_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 34 - 259
Target Start/End: Original strand, 1025389 - 1025614
Alignment:
| Q |
34 |
tgatctcaacatttacaacaaccatatccatgttatgctgaatatcttactnnnnnnnnngttatgctgaatatcaaccagaaaaatagtgttgctgttt |
133 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1025389 |
tgatgtcaacatttacaacaaccatatccaagttattctgaatatcttactaaaaaaaaagttatgctgaatatcaaccagaaaaatagtgttgctgttt |
1025488 |
T |
|
| Q |
134 |
tattatgattttttgtcctcgaaatcataacataaagtatcgcaaaaacaatcagaattaaaaattcacctacatggtatcgtatggtatcataaagaaa |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1025489 |
tattatgattttttgtcctcgaaatcataatataaagtatcgcaaaaataatcagaattaaaaattcacctacatggtatcgtatggtatcataaagaaa |
1025588 |
T |
|
| Q |
234 |
tgaataaaacttgattgcttttaatt |
259 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1025589 |
tgaataaaacttgattgcttttaatt |
1025614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University