View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10852_low_4 (Length: 294)
Name: NF10852_low_4
Description: NF10852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10852_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 30274306 - 30274128
Alignment:
| Q |
1 |
cgaatagtttgctatgaatttacggtgcttatggaagagtcagaatctaagagtttggcagaacatttcagagacgtgccaggccattacagttcgagca |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30274306 |
cgaatagtttgctatgaatttacggtggttatggaagagtcagaatctaagagtttggcagaacatttcagagatgtgccaggccattacagttcgagca |
30274207 |
T |
|
| Q |
101 |
aggcagctgttacatgactggagagaagcaaatatcagaaaattgtattctgatgcagctggaaacatagcagaaccga |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30274206 |
aggcagctgttacatgactggagagaagcaaatatcagaaaattgtattctgatgcagctggaaacatggcagaaccga |
30274128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 211 - 278
Target Start/End: Complemental strand, 30274126 - 30274059
Alignment:
| Q |
211 |
gcaaagtttgatgccatcacaagttaagtgggtaaaaccgcagcaagggaggttaaaatgtaatatag |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30274126 |
gcaaagtttgatgccatcacaagttaagtgggcaaaaccgcagcaagggaggttaaaatgtaatatag |
30274059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 27040425 - 27040291
Alignment:
| Q |
1 |
cgaatagtttgctatgaatttacggtgcttatggaagagtcagaatctaagagtttggcagaacatttcagagacgtgccaggccattacagttcgagca |
100 |
Q |
| |
|
|||| ||||||| ||||||||| || | ||||||||||||| |||||| || | |||||||| |||||||| || |||||||| ||| | | ||||||| |
|
|
| T |
27040425 |
cgaacagtttgcgatgaatttatggagtttatggaagagtcggaatcttcgaatatggcagaatatttcagaaacatgccaggctatttctgctcgagca |
27040326 |
T |
|
| Q |
101 |
aggcagctgttacatgactggagagaagcaaatat |
135 |
Q |
| |
|
||| ||||| ||| ||||||||||||||||| |
|
|
| T |
27040325 |
caacagatgttagttgagtggagagaagcaaatat |
27040291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University