View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10852_low_5 (Length: 291)
Name: NF10852_low_5
Description: NF10852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10852_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 51190080 - 51189790
Alignment:
| Q |
1 |
tgttccaaggtttgtcgaaatcagtagaagtggggagaatggaagtgatgagaggttgtggaggatttggatgccaattgcaaggagaacagttcaatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51190080 |
tgttccaaggtttgtcgaaatcagtagaagtggggagaatggaagtgatgagaggttgtggaggatttggatgccaattgcaaggagaacagttcaatgg |
51189981 |
T |
|
| Q |
101 |
tttgcaagacaagaaacaaactctgttcaattacaac---aacataaacatttagtttcaaacg------------------tttgattcattgtcggtt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51189980 |
tttgcaagacaagaaacaaactctgttcaattacaacaacaacataaacatttagtttcaaacgtttgatcattgtgtacattttgattcattgtcggtt |
51189881 |
T |
|
| Q |
180 |
taatcagataaaatatacttaccagaggattacaatcttataatatagcatgcaaatgcaaatgtgtggtttatgaatatgtagaagtaaaggtata |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51189880 |
taatcagataaaatatacttaccagaggattacaatcttataatatagc------atgcaaatgtgtggtttatgaatatgtagaagtaaaggtata |
51189790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University