View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10852_low_6 (Length: 287)
Name: NF10852_low_6
Description: NF10852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10852_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 9e-42; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 155 - 265
Target Start/End: Complemental strand, 5190371 - 5190261
Alignment:
| Q |
155 |
gttgttgactaatccagtgtctaaatattcatcttttaaaggtgaataaatagaatgtctatggtttagactctaacatctatatatattatgcaatgtc |
254 |
Q |
| |
|
|||||||||||||| |||||||||| | |||||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
5190371 |
gttgttgactaatctagtgtctaaaaactcatcttttaaaggtgaataaataaaatgtctatggtttaaactctaacatctacatatattatgcaatgtc |
5190272 |
T |
 |
| Q |
255 |
catacaaatta |
265 |
Q |
| |
|
||||||||||| |
|
|
| T |
5190271 |
catacaaatta |
5190261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 52 - 114
Target Start/End: Complemental strand, 5190446 - 5190384
Alignment:
| Q |
52 |
gagaatttaattgatattatgaaaaggcaaagataaacttaaaaagaacaaagatcaaatttc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5190446 |
gagaatttaattgatattatgaaaaggcaaagataaacttaaaaagaacgaagatcaaatttc |
5190384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 17 - 54
Target Start/End: Complemental strand, 5190806 - 5190769
Alignment:
| Q |
17 |
agaatttgcagatccttacatgccactacccaattgag |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5190806 |
agaatttgcagatccttacatgccactacccaattgag |
5190769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University