View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10852_low_6 (Length: 287)

Name: NF10852_low_6
Description: NF10852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10852_low_6
NF10852_low_6
[»] chr5 (3 HSPs)
chr5 (155-265)||(5190261-5190371)
chr5 (52-114)||(5190384-5190446)
chr5 (17-54)||(5190769-5190806)


Alignment Details
Target: chr5 (Bit Score: 87; Significance: 9e-42; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 155 - 265
Target Start/End: Complemental strand, 5190371 - 5190261
Alignment:
155 gttgttgactaatccagtgtctaaatattcatcttttaaaggtgaataaatagaatgtctatggtttagactctaacatctatatatattatgcaatgtc 254  Q
    |||||||||||||| |||||||||| | |||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||    
5190371 gttgttgactaatctagtgtctaaaaactcatcttttaaaggtgaataaataaaatgtctatggtttaaactctaacatctacatatattatgcaatgtc 5190272  T
255 catacaaatta 265  Q
    |||||||||||    
5190271 catacaaatta 5190261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 52 - 114
Target Start/End: Complemental strand, 5190446 - 5190384
Alignment:
52 gagaatttaattgatattatgaaaaggcaaagataaacttaaaaagaacaaagatcaaatttc 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
5190446 gagaatttaattgatattatgaaaaggcaaagataaacttaaaaagaacgaagatcaaatttc 5190384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 17 - 54
Target Start/End: Complemental strand, 5190806 - 5190769
Alignment:
17 agaatttgcagatccttacatgccactacccaattgag 54  Q
    ||||||||||||||||||||||||||||||||||||||    
5190806 agaatttgcagatccttacatgccactacccaattgag 5190769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University