View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10853_6 (Length: 368)
Name: NF10853_6
Description: NF10853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10853_6 |
 | |
|
| [»] scaffold0036 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0036 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 118 - 231
Target Start/End: Original strand, 10277 - 10390
Alignment:
| Q |
118 |
cctgaacgaatttataactgtttctggtggccgacggcgaactccggcgacgttttccgagcagtcgaattcagtcttcagtgcgattccaactcgcaca |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10277 |
cctgaacgactttataactgtttctggtggccgacggcgaactccggcgacgttttccgagcagtcgaattcagtcttcagtgcgattccaactcgcaca |
10376 |
T |
|
| Q |
218 |
atttagcgcgaaac |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10377 |
atttagcgcgaaac |
10390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 10160 - 10248
Alignment:
| Q |
1 |
gaaatgctatccaagattgattgaaaataaatcctaatcacttgagatcctaaatcctaattgcaatctcaacttagccaagaataatt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10160 |
gaaatgctatccaagattgattgaaaataaatcctaatcacttcagatccaaaatcctaattgcaatctcaacttagccaagaataatt |
10248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 361
Target Start/End: Original strand, 10457 - 10520
Alignment:
| Q |
298 |
ggcttggtgaatgatgggcccttcnnnnnnngtggaacgggcttcatattaaacttcatctctc |
361 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||| ||| |||| |
|
|
| T |
10457 |
ggcttgatgaatgatgggcccttcaaaaaaagtggaacgggcttcatattaaactccatttctc |
10520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University