View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10853_low_2 (Length: 281)
Name: NF10853_low_2
Description: NF10853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10853_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 17 - 271
Target Start/End: Complemental strand, 45934761 - 45934507
Alignment:
| Q |
17 |
attatgttcattgtttttagcatgcatgtagtgtattagtatgtatgtaacattaccgttctagccagtacgcaaatggagctatcgaaaccgtcgcaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934761 |
attatgttcattgtttttagcatgcatgtagtgtattagtatgtatgtaacattaccgttctagccagtacgcaaatggagctatcgaaaccgtcgcaaa |
45934662 |
T |
|
| Q |
117 |
gatctgacggtatgcaactaggatgagaggattcattccaccaagaattgcaattttggatgttatgttcattcctgcgtatgcaagttgcattacaatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934661 |
gatctgacggtatgcaactaggatgagaggattcattccaccaagaattgcaattttggatgttatgttcattcctgcgtatgcaagttgcattacaatc |
45934562 |
T |
|
| Q |
217 |
atcaaaactaaaggaataatactagcacttcccatgatctctttaaagttctctg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45934561 |
atcaaaactaaaggaataatactagcacttcccatgatctctttaaagttttctg |
45934507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University