View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10854_2 (Length: 374)
Name: NF10854_2
Description: NF10854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10854_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 31354364 - 31354581
Alignment:
| Q |
1 |
ttttttatgtttgatgaatctcagtggttacatggctcctgaatatgcattgcgtggatatctttctgtaaagactgatgttttcagttatggagtcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31354364 |
ttttttatgtttgatgaatctcagtggttacatggctcctgaatatgcattgcgtggatatctttctgtaaagactgatgttttcagttatggagtcttg |
31354463 |
T |
|
| Q |
101 |
gtgttggaaatagttagcgggagaaaaaaccatgatctgaagcttgatgcagaaaaggcagatctcctaagctatgtaagttgttctcatggaaggcatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31354464 |
gtgttggaaatagttagcgggagaaaaaaccatgatctgaagcttgatgcagaaaaggcagatcttctaagctatgtaagttgttctcatggaaggcatg |
31354563 |
T |
|
| Q |
201 |
aaagaaaatttagtatgt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31354564 |
aaagaaaatttagtatgt |
31354581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 219 - 356
Target Start/End: Original strand, 31354703 - 31354840
Alignment:
| Q |
219 |
caacagttgtcacattaaggaagcagaagttctcgaccctctttgtgctcacggctgaaacactaacttaatcagcacatgttacacaaaaataaacaaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31354703 |
caacagttgtcacattaaggaagcagaagttctcgaccctctttgtgctcacggctgaaacactaacttaatcagcacatgttacacaaaaataaacaaa |
31354802 |
T |
|
| Q |
319 |
tatgtatgcatcaaaattcaactcattaattttttcgt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31354803 |
tatgtatgcatcaaaattcaactcattaattttttcgt |
31354840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University