View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10854_low_1 (Length: 301)
Name: NF10854_low_1
Description: NF10854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10854_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 66 - 283
Target Start/End: Original strand, 4284361 - 4284577
Alignment:
| Q |
66 |
ccgccattggtgtcttctagaagctctgtgattatgtgttcgtggaattgaagaaccattgatgaataataatggatgcaaattgaagaagttcgaattt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4284361 |
ccgccattggtgtcttctagaagctctgtgattatgtgttcgtggaattgaagaaccattgatgaataataatggatgcaaattgaagaagttcgaattt |
4284460 |
T |
|
| Q |
166 |
gatttgattgttactgagnnnnnnntttaggtttggaactgcaaattctcgaaggaatgaagcattccaagtttcaactgtaaaaccagtgaaccgcgaa |
265 |
Q |
| |
|
||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4284461 |
gatttgattattactgag-aaaaaatttaggttttgaactgcaaattctcgaaggaatgaagcattccaagtttcaactgcaaaaccagtgaaccgcgaa |
4284559 |
T |
|
| Q |
266 |
aatgtgaactgcgaaact |
283 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4284560 |
aatgtgaactgcgaaact |
4284577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 70 - 126
Target Start/End: Original strand, 23429422 - 23429478
Alignment:
| Q |
70 |
cattggtgtcttctagaagctctgtgattatgtgttcgtggaattgaagaaccattg |
126 |
Q |
| |
|
||||||||||||||||||| | |||||||||| | |||||||||||||||||||| |
|
|
| T |
23429422 |
cattggtgtcttctagaagttaagtgattatgtttgtgtggaattgaagaaccattg |
23429478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University