View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_high_13 (Length: 290)
Name: NF10855A_high_13
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 12 - 177
Target Start/End: Original strand, 32907352 - 32907519
Alignment:
| Q |
12 |
atgaatgaataaatcaatgaaaatcctgacaaaatactctcactttat--cctatattatgtgtgaaccactcaataatcctcccattaattgtcactcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32907352 |
atgaatgaataaatcaatgaaaatcctgacaaaatactctcactttatatcctatattatgtatgaaccactcaataatcctcccactaattgtcactcc |
32907451 |
T |
 |
| Q |
110 |
tctcttggttagcaaatcagcagaattgttggcttccctattcactcctctcttttgtattttctgtc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32907452 |
tctcttggttagcaaatcagcagaattgttggcttccctgttcactcctctcttttgtattttctgtc |
32907519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 189 - 290
Target Start/End: Original strand, 32907580 - 32907681
Alignment:
| Q |
189 |
tgtagcatgtcttaaaacttaatatattaaaccttatatggagggtattctgccattggatggatttgcttccaggtaactgtaatgaaatactactggc |
288 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32907580 |
tgtagcatgtcttaaaacttaatgtattaaactttatatggagggtattcttccattggatggatttgcttccaggtaattgtaatgaaatactactggc |
32907679 |
T |
 |
| Q |
289 |
tt |
290 |
Q |
| |
|
|| |
|
|
| T |
32907680 |
tt |
32907681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University