View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_112 (Length: 350)
Name: NF10855A_low_112
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_112 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 51 - 350
Target Start/End: Complemental strand, 402068 - 401769
Alignment:
| Q |
51 |
tggtgtgctgggaggctgctaacccaaacaattggtttctgtgtttgaagggtgttggaagaccnnnnnnnnctctctcaattgcttgaagccggctggt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
402068 |
tggtgtgctgggaggctgctaacccaaacaattggtttctgtgtttgaagggtgttggaagaccaaaaaaaactctctcaattgcttgaagccggctggt |
401969 |
T |
|
| Q |
151 |
ttaactgggaataaaatcgagattgtatttatgagatgccagaataaatatttgctggttttcggagatttcattcaacgaaacattataggtctcaatc |
250 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401968 |
ttaactgtggataaaatcgagattgtatttatgagatgccagaataaatatttgctggttttcggagatttcattcaacgaaacattataggtctcaatc |
401869 |
T |
|
| Q |
251 |
ttcgaaccctttcaggtggaacaaacctctgaagtcttgccaatatagcgcctatggctatgggatgtggctgttgtgctggaatgggagagggctgtga |
350 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401868 |
ttcgaaccctttcagatggaacaaacctctgaagtcttgccaatatagcgcctatggctatgggatgtggctgttgtgctggaatgggagagggctgtga |
401769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University