View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_114 (Length: 349)
Name: NF10855A_low_114
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_114 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 7 - 345
Target Start/End: Original strand, 6956473 - 6956825
Alignment:
| Q |
7 |
attatccactaatagtctcattctttcagtttcatttaacttcaaatcttcaagcaacattttaatttaagtccttgacatgctgcaaatgaggttgcta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6956473 |
attatccactaatagtctcattctttcagtttcatttaacttcaaatcttcaagcaacattttaatttaagtccttgacatgctgcaaatgaggttgcta |
6956572 |
T |
 |
| Q |
107 |
ca--------------cacgaggataatgcaactattccttgtttctttgagcactatgagattgaagcttcactaaacatgaataattacccaaatgta |
192 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6956573 |
catactcaacttaacacacgaggataatgcaactattccttgtttctttgagcactatgagattgaagcttcactaaacgtgaataattacccaaatgta |
6956672 |
T |
 |
| Q |
193 |
cttttttcttcatgaatttgcttacttatcccacaaggaatgtaaaattaggtttgtattgcttaagtatctcagtgagcctataattttcttatacaat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6956673 |
cttttttcttcatgaatttgcttacttatcccacaaggaatgtcaaattaggtttgtattgcttaagtatctcagtgagcctataattttcttatacaat |
6956772 |
T |
 |
| Q |
293 |
gtagagtcaactagattctcatcaacatctttgccgagtttgatgtccatctc |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6956773 |
gtagagtcaactagattctcatcaacatctttgccgagtttgattcccatctc |
6956825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University