View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_132 (Length: 335)
Name: NF10855A_low_132
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_132 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 17 - 325
Target Start/End: Complemental strand, 6236647 - 6236342
Alignment:
| Q |
17 |
ctcaccacccagctttattgcttcttttctctctagagagggttcaggacttccttattataggattttgatgtaattctgccttttctgtttttgtttc |
116 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6236647 |
ctcaccaccctgctttattgcttcttttctctctagagagggttcaggacttccttattataggattttgatgtaattctgccttttctatttttgtttc |
6236548 |
T |
|
| Q |
117 |
ttcctgatgtagaccttgttatgggttctggccctctctagttttattgaatttcttcgcttgatcnnnnnnnnnnnnnnnttagattttcacctatcac |
216 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6236547 |
ttcctgatgtagactttgttatgggttctggccctcttcagttttattgaatttcttcgcttgat---aaaaaaaaaaaaattagattttcacctatcac |
6236451 |
T |
|
| Q |
217 |
ctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtgggaacactataatttagaaaca |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6236450 |
ctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtgggaacactaaaatttagaaaca |
6236351 |
T |
|
| Q |
317 |
ccatgatat |
325 |
Q |
| |
|
||||||||| |
|
|
| T |
6236350 |
ccatgatat |
6236342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 198 - 303
Target Start/End: Original strand, 33891807 - 33891908
Alignment:
| Q |
198 |
ttagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtggga |
297 |
Q |
| |
|
||||||||||||| || | |||||||||||||| ||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33891807 |
ttagattttcacccataaactaggttttcaatta----taactaaagtgaaaagggaaatatggtttctaggacttcttttacttttgttgaatgtgggg |
33891902 |
T |
|
| Q |
298 |
acacta |
303 |
Q |
| |
|
|||||| |
|
|
| T |
33891903 |
acacta |
33891908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 198 - 303
Target Start/End: Complemental strand, 33952441 - 33952340
Alignment:
| Q |
198 |
ttagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtggga |
297 |
Q |
| |
|
||||||||||||| || | |||||||||||||| ||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33952441 |
ttagattttcacccataaactaggttttcaatta----taactaaagtgaaaagggaaatatggtttctaggacttcttttacttttgttgaatgtgggg |
33952346 |
T |
|
| Q |
298 |
acacta |
303 |
Q |
| |
|
|||||| |
|
|
| T |
33952345 |
acacta |
33952340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University