View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_171 (Length: 299)
Name: NF10855A_low_171
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_171 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 9e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 160 - 266
Target Start/End: Original strand, 15078174 - 15078280
Alignment:
| Q |
160 |
gggtatcattgtgctatgtgcatgtcgacaaagggtgaaagacgcaaggttccaagtgattggggtggtgtgtggcgagcgaaaattccgccaaaggtga |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||||||||||||||| |||||| ||| || |||||||||||| |
|
|
| T |
15078174 |
gggtatcattgtgctatgtgcatgtcgacaaagacggaaagacacaaggttccaggtgattggggtggtgtgtagcgagcaaaagtttcgccaaaggtga |
15078273 |
T |
|
| Q |
260 |
gaaattt |
266 |
Q |
| |
|
| ||||| |
|
|
| T |
15078274 |
ggaattt |
15078280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 54 - 104
Target Start/End: Complemental strand, 26793133 - 26793083
Alignment:
| Q |
54 |
aagtaagagccatacaagatccttcattgagttcaatacagtcaagttgga |
104 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
26793133 |
aagtaagaatcatgcaagatccttcattgaggtcaatacaatcaagttgga |
26793083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University