View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_177 (Length: 295)
Name: NF10855A_low_177
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_177 |
 | |
|
| [»] scaffold0096 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 7 - 173
Target Start/End: Complemental strand, 32650774 - 32650608
Alignment:
| Q |
7 |
agcatctcaattcgtttactctttcctttcattaatttgcattatcgccgtgataaatggatcagaattgttctgatatttacacaaatataaacaaacc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32650774 |
agcatctcaattcgtttactctttcctttcatttattttcattatggccgtgatgaatggatcagaattgttctgatatttacacaaatataaacaaacc |
32650675 |
T |
|
| Q |
107 |
cctcatgaaatgatttcagttaatcattatgattgttcacgttctggtactttttcctttggattcc |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32650674 |
cctcatgaaatgatttcagttaatcattatgattgttcacgttctggtactttttcctttggattcc |
32650608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: scaffold0096
Description:
Target: scaffold0096; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 169 - 295
Target Start/End: Original strand, 29175 - 29304
Alignment:
| Q |
169 |
attcctaacgcccctgatgtt---tactttcttccaaggaagttttaccacacatttgagaagtccttgccaaaatctgatgtcaactcaggatttttgg |
265 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
29175 |
attcctaacgcccttgatgttgtttactttcttccaaggaagttttaccactcatttgagaagtcgttgccaaaatctgatgtcaactcaggttttttgg |
29274 |
T |
|
| Q |
266 |
tatgatgtcttttgaatttgtatgtctatg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29275 |
tatgatgtcttttgaatttgtatgtctatg |
29304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 169 - 275
Target Start/End: Complemental strand, 12537407 - 12537298
Alignment:
| Q |
169 |
attcctaacgcccctgatgtt---tactttcttccaaggaagttttaccacacatttgagaagtccttgccaaaatctgatgtcaactcaggatttttgg |
265 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
12537407 |
attcctaacgcccctgatgttgtttactttcttccaaggaagttttaccacacatttgagaagtagttgccaaaatctgatgtcaactcaggttttttgg |
12537308 |
T |
|
| Q |
266 |
tatgatgtct |
275 |
Q |
| |
|
|||||||||| |
|
|
| T |
12537307 |
tatgatgtct |
12537298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University