View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_197 (Length: 284)
Name: NF10855A_low_197
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_197 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 115 - 251
Target Start/End: Complemental strand, 15827348 - 15827214
Alignment:
| Q |
115 |
cttgactcatatgctttaacaatttcatgaagaaatcacaatagtctagcttgtctatcagcagaagtattgaggcatatcaagtgtcaagtaaaaaggt |
214 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15827348 |
cttgactcatatgctt-aacaatttcatgaagaaatcacaagagtctagcttgtctatcagcagaagtattgaggcatatcaggtgtcaagtaaaaaggt |
15827250 |
T |
|
| Q |
215 |
atagtcttatctcaaatgcaatcatagatcacctaaa |
251 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15827249 |
atagtcttatctc-aatgcaatcatagatcacctaaa |
15827214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 18 - 122
Target Start/End: Complemental strand, 15827599 - 15827495
Alignment:
| Q |
18 |
catcaaaatacaaaatgttggttatatcataagaaattccacttgcgagtcatatcccaatgttcaaaatgaaattttttatgagagaaaccatacactt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15827599 |
catcaaaatacaaaatgttggttatatcatgagaaattccacttgcgagtcatatcccaatgttcaaaatgaaattttttatgagagaaaccatacactt |
15827500 |
T |
|
| Q |
118 |
gactc |
122 |
Q |
| |
|
||||| |
|
|
| T |
15827499 |
gactc |
15827495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 203 - 260
Target Start/End: Original strand, 5600618 - 5600674
Alignment:
| Q |
203 |
aagtaaaaaggtatagtcttatctcaaatgcaatcatagatcacctaaaaagagaaga |
260 |
Q |
| |
|
||||||||| || ||||| ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
5600618 |
aagtaaaaacatagagtctcatctcaa-tgtaatcatagatcacctaaaaagagaaga |
5600674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University