View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_206 (Length: 277)
Name: NF10855A_low_206
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_206 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 7 - 261
Target Start/End: Complemental strand, 24511831 - 24511574
Alignment:
| Q |
7 |
atttaatgggatacatcttagttgtagttttgtttttctagatgaccgataggaactcttttacttcctataagt-tttagtcttttgcttattgttctt |
105 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| || | ||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24511831 |
atttagtgggatacatcttagttgtagttttgtttcccttgttgaccgataggaactctttcacttcctataagtatttagtcttttgcttattgttct- |
24511733 |
T |
|
| Q |
106 |
gtggttagagtttaagccc-atttattcataattaaaaaaatattcattcataatt---nnnnnnnnncatagtgcagtacaataccacnnnnnnngttt |
201 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |||||||||||||||||| || |||| |
|
|
| T |
24511732 |
-tggttagagtttaagccctatttattcataattaaaaaaatatttattcataattaaaaaaaaaaaacatagtgcagtacaatacgactttttttgttt |
24511634 |
T |
|
| Q |
202 |
gtttgacctgtagtattgcagtacaatacgacttatttcctttattatagccaatgatgt |
261 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24511633 |
gtttgacttgtagtattgcagtacaatacgacttatttcctttattatagccaatgatgt |
24511574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University